Sequence ID | >WENV180098469 |
Genome ID | MTBK01247037 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1334 |
End posion on genome | 1250 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
acgttttatc |
tRNA gene sequence |
GCCCGGGTGGCGAAATTGGCAGACGCGCATGGTTGAGGGCCATGTAACGGTTACGTTATG |
Downstream region at tRNA end position |
tttttgatta |
Secondary structure (Cloverleaf model) | >WENV180098469 Leu GAG c ACat tttttgatta G + T C - G C - G C - G G - C G - C G - C T G T C G C C C A T A A G | | | | | A T A G C G G C G G G C G | | | T T G A C G C C A G G TAACGGTTACGTTAT C - G A - T T - A G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |