Sequence ID | >WENV180098476 |
Genome ID | MTBK01247842 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3525 |
End posion on genome | 3450 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tagattcatt |
tRNA gene sequence |
TGACCTATAGCAAAGTTGGTAATGCACCGGACTGCAAATCCGTTATGCGTGAGTTCGAGT |
Downstream region at tRNA end position |
tttattttca |
Secondary structure (Cloverleaf model) | >WENV180098476 Cys GCA t TCCA tttattttca T - A G - C A - T C - G C - G T - A A - T T G T C A C T C A T G A A | | | | | G T A A C G G T G A G C G | | | T T G A T G C T A A TATGC C T C - G G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |