Sequence ID | >WENV180098480 |
Genome ID | MTBK01248361 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1496 |
End posion on genome | 1568 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gagcaagtaa |
tRNA gene sequence |
GCCGGCATAGCTCAATGGCAGAGCAACTGTTTTGTAAACAGTAGGTTGGGGGTTCAAATC |
Downstream region at tRNA end position |
taattgacaa |
Secondary structure (Cloverleaf model) | >WENV180098480 Thr TGT a TCaa taattgacaa G - C C - G C - G G - C G - C C - G A - T T A T C T G C C A A A A | + | | A T C T C G G G G G G C G | | | | T T G G A G C C A A AGGTT A - T C - G T - A G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |