Sequence ID | >WENV180098492 |
Genome ID | MTBK01249663 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 394 |
End posion on genome | 309 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ataattgtga |
tRNA gene sequence |
GCCGAGATACCAAAGTGGACAACTGGGGCTGACTGTAAATCAGCTGGCTTACGCCTACGG |
Downstream region at tRNA end position |
aaatatatgt |
Secondary structure (Cloverleaf model) | >WENV180098492 Tyr GTA a ACCA aaatatatgt G - C C - G C - G G - C A - T G - C A - T T A T C T C C C A T G A A | + | | | G G A A C C G G G G G C G | | | T T A C T G G C A A G TGGCTTACGCCTAC G - C C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |