Sequence ID | >WENV180098499 |
Genome ID | MTBK01250028 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1113 |
End posion on genome | 1187 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cggttatttg |
tRNA gene sequence |
GGCCTAGTCGCCAAGTGGTAAGGCAAGAGTCTGCAAAACTCTTATACGGCGGTTCGATTC |
Downstream region at tRNA end position |
aaattgaata |
Secondary structure (Cloverleaf model) | >WENV180098499 Cys GCA g TCCA aaattgaata G - C G - C C - G C - G T - A A - T G - C T T T C C G C C A G A C | | | | | G T A C C G G G C G G C G | | | T T G A G G C T A A TATAC A - T G - C A - T G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |