Sequence ID | >WENV180098509 |
Genome ID | MTBK01250466 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 335 |
End posion on genome | 409 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gtgctccaat |
tRNA gene sequence |
GCTTTTGTAGCTCAATGGTAGAGCAAACCTTTCGTAAGGGTAAGGTTATGGGTTCAAGTC |
Downstream region at tRNA end position |
caatataaat |
Secondary structure (Cloverleaf model) | >WENV180098509 Thr CGT t TCCA caatataaat G - C C - G T - A T - A T - A T - A G - C T G T T C C C C A A A A | | | | A T C T C G A T G G G C G | | | | T T G G A G C T A A AGGTT A A A - T C - G C - G T + G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |