Sequence ID | >WENV180098517 |
Genome ID | MTBK01251027 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1205 |
End posion on genome | 1131 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
atagttaact |
tRNA gene sequence |
GCGGGCTTAATTCAATGGGAGAAATTCATCCTTACAAGGTGAAAGTTGTTAGTTCAAGTC |
Downstream region at tRNA end position |
tagtttttga |
Secondary structure (Cloverleaf model) | >WENV180098517 Val TAC t ACCA tagtttttga G - C C - G G - C G - C G + T C - G T - A T G T C A A T C A A A A | | | | | A T C T T A G T T A G C G | | | T T G G A A A G A T AAGTT T - A C - G A - T T + G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |