Sequence ID | >WENV180098530 |
Genome ID | MTBK01251655 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 88 |
End posion on genome | 171 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
accaactgta |
tRNA gene sequence |
GGAAGCGTCGCATAGTGGTTAATTGCACTGGTTTCGAAAACCAGAGCCTCACGGCTTCGT |
Downstream region at tRNA end position |
cctaggattc |
Secondary structure (Cloverleaf model) | >WENV180098530 Ser CGA a GCat cctaggattc G - C G - C A - T A - T G - C C - G G - C T A T C A C C C A T G A C | | | | | G G T A C G G T G G G C G | | | T T T T T G C T A A A AGCCTCACGGCTTC C - G T - A G - C G - C T - A T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |