Sequence ID | >WENV180098545 |
Genome ID | MTBK01252512 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 280 |
End posion on genome | 199 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ccattaatgt |
tRNA gene sequence |
GGGCGAGTGGTGGAATGGCAGACACGCTAGATTTAGGATCTAGTGCCGCGAGGCGTAGGA |
Downstream region at tRNA end position |
cggcccgtta |
Secondary structure (Cloverleaf model) | >WENV180098545 Leu TAG t ACta cggcccgtta G - C G - C G - C C - G G - C A - T G - C T G T T C C T C A T A A G | | | | | A G G G T G A G G A G C G | | | T T C A C A C A G G TGCCGCGAGGCGT C - G T - A A - T G - C A - T T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |