Sequence ID | >WENV180098550 |
Genome ID | MTBK01252603 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 512 |
End posion on genome | 428 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ggccccagcc |
tRNA gene sequence |
GCCCGCGTGACGAAATCGGTAGACGTAGCGGACTCAAAATCCGCCGCCGCAAGGCGTGCC |
Downstream region at tRNA end position |
ggaccgacgc |
Secondary structure (Cloverleaf model) | >WENV180098550 Leu CAA c ACCA ggaccgacgc G - C C - G C - G C - G G - C C - G G - C T G T C G G T C A T A A G | | | | | G C A G C A G C C A G C G | | | T T G A C G T T A G A CGCCGCAAGGCGT G - C C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |