Sequence ID | >WENV180098563 |
Genome ID | MTBK01254237 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1904 |
End posion on genome | 1830 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
ttccagatat |
tRNA gene sequence |
CGCGGGGTAGAGCAGTGGCAGCTCGTCAGGCTCATAACCTGAAGGTCGTTGGTTCGAATC |
Downstream region at tRNA end position |
ctatttctgt |
Secondary structure (Cloverleaf model) | >WENV180098563 fMet CAT t ACCA ctatttctgt C A G - C C - G G - C G - C G - C G - C T A T C A A C C A G A A | | | | | G T C G A G G T T G G C G | | | | T T G G C T C C A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |