Sequence ID | >WENV180098580 |
Genome ID | MTBK01255636 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 187634 |
End posion on genome | 187709 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ttgaaatgtg |
tRNA gene sequence |
GCGGCTATAGTTCAGTGGTTAGAGCGCCTGATTGTGGTTCAGGATGTCGAGGGTTCGAAT |
Downstream region at tRNA end position |
cccgtttctg |
Secondary structure (Cloverleaf model) | >WENV180098580 His GTG g CCCA cccgtttctg G - C C - G G - C G - C C - G T - A A - T T A T C T C C C A T G A A | | | | | G G C T T G G A G G G C G | | + | T T T G A G C T A G ATGTC C - G C - G T - A G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |