Sequence ID | >WENV180098582 |
Genome ID | MTBK01255636 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 111315 |
End posion on genome | 111241 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
cattatactc |
tRNA gene sequence |
GCCGTCTTAGCTCAGTGGTAGAGCACACGCTTCACACGCGTGGGGCCACAAGTTCAAATC |
Downstream region at tRNA end position |
tttcctgata |
Secondary structure (Cloverleaf model) | >WENV180098582 Val CAC c ACCA tttcctgata G - C C - G C - G G - C T - A C - G T - A T A T T G T T C A G A A | | | | | A T C T C G A C A A G C G | | | | T T G G A G C T A A GGGCC C - G A - T C - G G - C C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |