Sequence ID | >WENV180098644 |
Genome ID | MTBK01259177 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 18101 |
End posion on genome | 18175 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
attttgcagt |
tRNA gene sequence |
GGGGACTTAGCTCAGCGGCAGAGCGTTCGGTTCACATCCGAAAGGCCACAGGTTCAAGCC |
Downstream region at tRNA end position |
tttatttgca |
Secondary structure (Cloverleaf model) | >WENV180098644 Val CAC t ACCA tttatttgca G - C G - C G - C G - C A - T C - G T - A C G T T G T C C A G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C C A G AGGCC T - A T - A C - G G - C G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |