Sequence ID | >WENV180098666 |
Genome ID | MTBK01260571 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 909 |
End posion on genome | 995 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gcatcctttt |
tRNA gene sequence |
GCGGGGATTGCCAAGCCAGGTCAAAGGCGCTGGATTCAGGGTCCAGTCACGAAGGTGTTC |
Downstream region at tRNA end position |
aataaaccac |
Secondary structure (Cloverleaf model) | >WENV180098666 Leu CAG t ACCt aataaaccac G - C C - G G - C G - C G - C G - C A - T T A T T A C C C A C C G A T + | | | | G A A C C G G T G G G C G | | | T T G A G G C T C A A G TCACGAAGGTGTTC C - G T - A G - C G - C A - T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |