Sequence ID | >WENV180098675 |
Genome ID | MTBK01260929 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 11038 |
End posion on genome | 10965 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
atattatttc |
tRNA gene sequence |
GCCCCCGTAGCTCAATGGACAGAGCGCCGGTCTTCTAAACCGTAGGTTCCGCGTTCGAGT |
Downstream region at tRNA end position |
aatttgaatt |
Secondary structure (Cloverleaf model) | >WENV180098675 Arg TCT c GCta aatttgaatt G + T C - G C - G C - G C - G C - G G - C T G T G G C G C A T A A A | | | | | G G C T C G C C G C G C G | | | | T T A G A G C C A G AGGTT C T C - G G - C G - C T - A C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |