Sequence ID | >WENV180098685 |
Genome ID | MTBK01261338 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 804 |
End posion on genome | 720 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cttaacaaac |
tRNA gene sequence |
GCGCAGGTGACGAAATTGGTAAACGTGCTAGCTTGAGGGGCTAGTGCTCGCAAGAGCTTG |
Downstream region at tRNA end position |
tattctgata |
Secondary structure (Cloverleaf model) | >WENV180098685 Leu GAG c ACac tattctgata G - C C - G G - C C - G A - T G - C G - C T G T T C T C C A T A A G + | | | | A T A G C A G G A G G C G | | | T T G A C G T T A A G TGCTCGCAAGAGCTT C - G T - A A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |