Sequence ID | >WENV180098689 |
Genome ID | MTBK01261350 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1692 |
End posion on genome | 1603 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ctcgctggac |
tRNA gene sequence |
GGAGGTGTGTCCGAACTGGCTAAGGAGCCGGTCTTGAAAATCGGTGGTGGTCAAACCACC |
Downstream region at tRNA end position |
ttttttattc |
Secondary structure (Cloverleaf model) | >WENV180098689 Ser TGA c GCCA ttttttattc G - C G - C A - T G - C G - C T + G G - C T A T C A C C C A C A A G | | | | | G T G C C T G T G G G C G | | | T T G A G G A C T A G TGGTGGTCAAACCACCGT C - G C - G G - C G + T T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |