Sequence ID | >WENV180098694 |
Genome ID | MTBK01261894 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 36 |
End posion on genome | 123 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aaagtaacgt |
tRNA gene sequence |
GCGAAAGTGGTGGAATTGGCAGACTCGCTAGATTCAGGTTCTAGTGTGCAATACGCACGT |
Downstream region at tRNA end position |
caattgtccg |
Secondary structure (Cloverleaf model) | >WENV180098694 Leu CAG t ACCA caattgtccg G - C C - G G - C A - T A - T A - T G - C T A T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | T T G A C T C C A G G TGTGCAATACGCACGT C - G T - A A - T G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |