Sequence ID | >WENV180098744 |
Genome ID | MTBK01264422 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 188 |
End posion on genome | 99 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tatttattac |
tRNA gene sequence |
GGAGGATTACCCAAGTCCGGCTGAAGGGAACGGTCTTGAAAACCGTCAGGCGGGTAAAAC |
Downstream region at tRNA end position |
tatttatttt |
Secondary structure (Cloverleaf model) | >WENV180098744 Ser TGA c Tttt tatttatttt G - C G - C A - T G - C G - C A - T T - A T A T T T C T C A C T G A A | | | | | G C A C C C A A G A G C G | | | T T G A G G G C T G A A CAGGCGGGTAAAACCGTGC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |