Sequence ID | >WENV180098748 |
Genome ID | MTBK01264895 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 196 |
End posion on genome | 114 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
acgtacaggc |
tRNA gene sequence |
GCGAGTGTTACCGAGCGGCCAAAGGTGATCGACTCAAGATCGATTCTCGTAGGAGTTCGC |
Downstream region at tRNA end position |
cttttgtagt |
Secondary structure (Cloverleaf model) | >WENV180098748 Leu CAA c Atcc cttttgtagt G - C C - G G - C A - T G - C T - A G - C T A T C G T C C A C G A T | | | | | G G G C C A G C A G G C G | | | T T C A G G T C A A G TCTCGTAGGAGTTC A - T T - A C - G G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |