Sequence ID | >WENV180098755 |
Genome ID | MTBK01265182 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 108 |
End posion on genome | 25 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
atagaaaaag |
tRNA gene sequence |
GCCGAGGTGGCGAAACGGCAGACGCGTAGCGTTCAGAGCGCTATAGAGGTAACTCTGTGA |
Downstream region at tRNA end position |
actttttctc |
Secondary structure (Cloverleaf model) | >WENV180098755 Leu CAG g ACac actttttctc G - C C - G C - G G - C A - T G - C G - C T A T C T C C C A C A A G | | | | | A G A G C G G A G G G C G | | | T T C A C G C A G G TAGAGGTAACTCTGT T - A A - T G - C C - G G - C T G T A C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |