Sequence ID | >WENV180098759 |
Genome ID | MTBK01265349 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1098 |
End posion on genome | 1027 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tgtttggcac |
tRNA gene sequence |
GCCAACGTAGCTCAGTGGCAGAGCAGACGCTTCGTAAGCGCCCGGTCGAGGGTTCAACTC |
Downstream region at tRNA end position |
tgttcaaacc |
Secondary structure (Cloverleaf model) | >WENV180098759 Thr CGT c Tttt tgttcaaacc G - C C - G C - G A - T A - T C - G G - C T C T C T C C C A G A A | | | | | A T C T C G G A G G G C G | | | | T T G G A G C C A A CGGTC G - C A C C - G G - C C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |