Sequence ID | >WENV180098768 |
Genome ID | MTBK01266423 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2023 |
End posion on genome | 2109 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gaggcgtcgT |
tRNA gene sequence |
GCCCGAGTGGCGGAATTGGTAGACGCAAGGGACTTAAAATCCCTCGGAACTCAGTTCTGT |
Downstream region at tRNA end position |
gcttttgatg |
Secondary structure (Cloverleaf model) | >WENV180098768 Leu TAA T ATtg gcttttgatg G - C C - G C - G C - G G - C A - T G - C T G T T G G C C A T A A G | | | | | G T G G C G A C C G G C G | | | T T G A C G C T A G A CGGAACTCAGTTCTGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |