Sequence ID | >WENV180098769 |
Genome ID | MTBK01266468 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 654 |
End posion on genome | 565 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
actcctgttc |
tRNA gene sequence |
GGAGAGATGGCTGAGTGGCCGAAAGCAACGCACTGCTAATGCGTTGACCTCGTAAGGGGT |
Downstream region at tRNA end position |
ccacgcatgt |
Secondary structure (Cloverleaf model) | >WENV180098769 Ser GCT c GCCA ccacgcatgt G - C G - C A A G - C A - T G - C A C T A T C A C C C A T G A G | | | | | G G G T C G G T G G G C G | | | T T C A A G C C G A A TGACCTCGTAAGGGGTCC A - T C - G G - C C - G A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |