Sequence ID | >WENV180098778 |
Genome ID | MTBK01266864 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 25510 |
End posion on genome | 25584 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttttttatat |
tRNA gene sequence |
GGCGGCGTAGCTCAGAGGTAGAGCAGGCGGCTCATACCCGCCGTGTCCGGGGTTCGATTC |
Downstream region at tRNA end position |
aaacactgct |
Secondary structure (Cloverleaf model) | >WENV180098778 Met CAT t ACCA aaacactgct G - C G - C C - G G - C G - C C - G G - C T T T G T C C C A G A A | + | | | G A C T C G C G G G G C G | | | | T T G G A G C T A A GTGTC G - C G - C C - G G - C G - C C C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |