Sequence ID | >WENV180098780 |
Genome ID | MTBK01266864 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 50958 |
End posion on genome | 51032 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gcaccatggt |
tRNA gene sequence |
GGGCGGTTAGCTCAGTGGTAGAGCGCTTGCCTTACAAGCAAGAGGCCAGAGGTTCGAAAC |
Downstream region at tRNA end position |
aagcgggctc |
Secondary structure (Cloverleaf model) | >WENV180098780 Val TAC t ACCA aagcgggctc G - C G - C G - C C - G G - C G - C T - A A A T T C T C C A G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C T A G AGGCC C - G T - A T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |