Sequence ID | >WENV180098785 |
Genome ID | MTBK01266864 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 50748 |
End posion on genome | 50674 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tagaatacgt |
tRNA gene sequence |
GGGGATGTAGCTCAGTGGGAGAGCGCTTGCTTCGCAAGCAAGAGGTCGCCGGTTCGAATC |
Downstream region at tRNA end position |
atagctttcc |
Secondary structure (Cloverleaf model) | >WENV180098785 Ala CGC t ACCA atagctttcc G - C G - C G + T G - C A - T T - A G - C T A T T G G C C A G A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C C - G T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |