Sequence ID | >WENV180098792 |
Genome ID | MTBK01266969 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 685 |
End posion on genome | 596 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
caacataact |
tRNA gene sequence |
AGTGGGGTGTCCGAGTGGTTGAAGGAACTAGCTTGGAAAGCTAGAAAGGGCGCAAGTCCT |
Downstream region at tRNA end position |
aaaaactaaa |
Secondary structure (Cloverleaf model) | >WENV180098792 Ser GGA t GCCA aaaaactaaa A - T G - C T + G G - C G + T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T T A G G A T G A A AAAGGGCGCAAGTCCTTC C - G T - A A - T G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |