Sequence ID | >WENV180098808 |
Genome ID | MTBK01268360 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 864 |
End posion on genome | 945 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cctcacaatt |
tRNA gene sequence |
GCGCGAGTGGTGAAATGGCATACACGCCAGACTTAGGATCTGGTCCGAAAGGGTGGGGGT |
Downstream region at tRNA end position |
attcatcagt |
Secondary structure (Cloverleaf model) | >WENV180098808 Leu TAG t ACCA attcatcagt G - C C - G G - C C - G G - C A - T G - C T G T C C C C C A T A A G | | | | | A G A G T G G G G G G C G | | | T T C A C A C A T G TCCGAAAGGGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |