Sequence ID | >WENV180098814 |
Genome ID | MTBK01268487 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3357 |
End posion on genome | 3431 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
ccataatttt |
tRNA gene sequence |
GGGCCCATAGCTCAGCGGTAGAGCGACCGGCTCATAACCGGTTGGTCCCTGGTTCGAATC |
Downstream region at tRNA end position |
aaagccaaag |
Secondary structure (Cloverleaf model) | >WENV180098814 Ile2 CAT t ACCA aaagccaaag G - C G - C G - C C - G C - G C - G A - T T A T G G G C C A G A A | | + | | G C C T C G C C T G G C G | | | | T T G G A G C T A G TGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |