Sequence ID | >WENV180098816 |
Genome ID | MTBK01268537 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 135 |
End posion on genome | 49 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aatcccttaa |
tRNA gene sequence |
GCCCAGGTGACGGAATTGGCAGACGCACTAGTTTCAGGGACTAGCGAGGGCAACCTTGTG |
Downstream region at tRNA end position |
taagcggaga |
Secondary structure (Cloverleaf model) | >WENV180098816 Leu CAG a ACCA taagcggaga G - C C - G C - G C - G A C G - C G - C C C T T G T C C C T A A G + | | | | G T G G C A G C A G G C G | | T T G A C G C C A G A CGAGGGCAACCTTGT C - G T - A A - T G - C T - A T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |