Sequence ID | >WENV180098822 |
Genome ID | MTBK01268905 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1564 |
End posion on genome | 1468 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
tacccccggt |
tRNA gene sequence |
GGAAGCGGTCGGGTCCTGGTGGGTCCCCCGGACTTCAAATCCGGTGTGGGGCGCGTCGAG |
Downstream region at tRNA end position |
tgttcttcct |
Secondary structure (Cloverleaf model) | >WENV180098822 SeC TCA t GCCA tgttcttcct G - C G - C A - T A - T G - C C - G G - C G G T T T T G T C C A T C C C + | | | | G G T G G G G C A G G C G + + | | T T T G T C C G G C TGTGGGGCGCGTCGAGCGTCCTGG C - G C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |