Sequence ID | >WENV180098859 |
Genome ID | MTBK01271327 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 829 |
End posion on genome | 745 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tccacgcctc |
tRNA gene sequence |
GCCGCGGTGCTGGAATTGGTAGACAGGACGGACTTAAAATCCGTTGTCAGTAATGATGTG |
Downstream region at tRNA end position |
atgatgcaaa |
Secondary structure (Cloverleaf model) | >WENV180098859 Leu TAA c ACat atgatgcaaa G - C C - G C - G G - C C - G G - C G - C T G T C A C C C A T A A G | | | | | A T G G T C G T G G G C G | | | T T G A C A G T A G G TGTCAGTAATGATGT A - T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |