Sequence ID | >WENV180098866 |
Genome ID | MTBK01271940 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1512 |
End posion on genome | 1601 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gtaaaaccgc |
tRNA gene sequence |
GGAGAGTTGCCAGAGCGGTTGAATGGGACGGTCTCGAAAACCGTTGTATCCTTACGGGTA |
Downstream region at tRNA end position |
ccttcttgcc |
Secondary structure (Cloverleaf model) | >WENV180098866 Ser CGA c GCCA ccttcttgcc G - C G - C A - T G - C A - T G - C T - A T A T G T C C C A C G A G | | | | | G G G A C C C A G G G C G | | | T T T A T G G T G A G TGTATCCTTACGGGTACC A - T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |