Sequence ID | >WENV180098876 |
Genome ID | MTBK01272579 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1362 |
End posion on genome | 1272 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gaaggcacat |
tRNA gene sequence |
GGAGAAATACTCAAGTGGCTGAAGAGGCGCCCCTGCTAAGGGCGTAGGTCGGGCAACTGG |
Downstream region at tRNA end position |
taagacatct |
Secondary structure (Cloverleaf model) | >WENV180098876 Ser GCT t GCCA taagacatct G - C G - C A - T G - C A - T A - T A - T T A T G G C C C A T G A A | | | | | A G A C T C C C G G G C G | | | T T C A G A G T G A G TAGGTCGGGCAACTGGCGC C - G G - C C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |