Sequence ID | >WENV180098877 |
Genome ID | MTBK01272670 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 741 |
End posion on genome | 828 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gggccaacct |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCACGCTTGGAAAGCGTGTTGAGTGAAAGCTCTC |
Downstream region at tRNA end position |
acgccgtccc |
Secondary structure (Cloverleaf model) | >WENV180098877 Ser GGA t GCCA acgccgtccc G - C G - C A - T G - C G - C A - T T - A T A T T C C C C A T G A C | | | | | G G T C C G A G G G G C G | | | T T C T G G C C T A G TTGAGTGAAAGCTCTC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |