Sequence ID | >WENV180098881 |
Genome ID | MTBK01272940 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 569 |
End posion on genome | 653 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ccgcgagcga |
tRNA gene sequence |
GCGGGCGTGGCGGAACTGGTAGACGCGCCGGATTTAGGTTCCGGTGGCGAAAGTCGTGGG |
Downstream region at tRNA end position |
tgcccgtcgg |
Secondary structure (Cloverleaf model) | >WENV180098881 Leu TAG a ACCA tgcccgtcgg G - C C - G G - C G - C G - C C - G G - C T G T C T C C C A C A A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TGGCGAAAGTCGT C - G C - G G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |