Sequence ID | >WENV180098902 |
Genome ID | MTBK01274014 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 146 |
End posion on genome | 57 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ccttcccggc |
tRNA gene sequence |
GGTGGCGTGTCCGAGCGGCCTAAGGAGCACGCCTCGAAAGCGTGTGTGGGTGCAAGCCCA |
Downstream region at tRNA end position |
acgcaaaacc |
Secondary structure (Cloverleaf model) | >WENV180098902 Ser CGA c GCCA acgcaaaacc G - C G - C T - A G - C G - C C - G G - C T A T C A C C C A C G A G | | | | | A G G C C T G T G G G C G | | | T T C A G G A C T A G TGTGGGTGCAAGCCCACC C - G A - T C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |