Sequence ID | >WENV180098904 |
Genome ID | MTBK01274104 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1658 |
End posion on genome | 1744 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tttgacaatc |
tRNA gene sequence |
GCCCGGGTGGCGGAAATGGTAGACGCGTTGGACTTAAAATCCAATGACCAGCAGTGGTCG |
Downstream region at tRNA end position |
ttaaaaaaac |
Secondary structure (Cloverleaf model) | >WENV180098904 Leu TAA c ACtt ttaaaaaaac G + T C - G C - G C - G G - C G - C G + T T T T C G G C C A A A A G | | | | | A T G G C G G C C G G C G | | | T T G A C G C T A G G TGACCAGCAGTGGTCGT T - A T - A G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |