Sequence ID | >WENV180098917 |
Genome ID | MTBK01274979 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2534 |
End posion on genome | 2624 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aatgatttgc |
tRNA gene sequence |
GGAGAGGTGCTGGAGTCCGGTTGAACAGGCACGCCTGGAGAGCGTGTGAAGGCTTTGCTT |
Downstream region at tRNA end position |
tctttattaa |
Secondary structure (Cloverleaf model) | >WENV180098917 Ser GGA c GCCA tctttattaa G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A C T G A G | | | | | G C G G T C G A G G G C G | | | T T G A C A G T T G A G TGAAGGCTTTGCTTTCC C - G A - T C - G G - C C - G C A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |