Sequence ID | >WENV180098920 |
Genome ID | MTBK01275321 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 207 |
End posion on genome | 123 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcctccggtc |
tRNA gene sequence |
GCGGCCGTGGCGGAATTGGTAGACGCGCTAGCTTGAGGTGCTAGTGGGGAGACCCGTGTT |
Downstream region at tRNA end position |
agaggatgaa |
Secondary structure (Cloverleaf model) | >WENV180098920 Leu GAG c ACCA agaggatgaa G - C C - G G - C G - C C - G C - G G - C T G T T A A C C A T A A G + | | | | G T G G C G G T T G G C G | | | T T G A C G C T A G G TGGGGAGACCCGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |