Sequence ID | >WENV180098939 |
Genome ID | MTBK01276619 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1116 |
End posion on genome | 1187 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ggtgcatcct |
tRNA gene sequence |
GCCTGGGTGGGGTAATGGCTATCCTAAGGGATTGTGGTTCCATCGATCTGGGTTCAATTC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180098939 His GTG t Cnnn nnnnnnnnnn G - C C - G C - G T - A G - C G - C G + T T T T G G C C C A T A A G | + | | | A G T G G G C T G G G C G | | + T T C T C C T T A A CGAT A - T G A G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |