Sequence ID | >WENV180098950 |
Genome ID | MTBK01277639 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 17032 |
End posion on genome | 16957 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aattgtctaa |
tRNA gene sequence |
GCCCAGATAGCTCAGTCGGTAGAGCAACGGACTGAAAATCCGTGTGTCGACGGTTCGATT |
Downstream region at tRNA end position |
gaaatttatt |
Secondary structure (Cloverleaf model) | >WENV180098950 Phe GAA a ACCA gaaatttatt G - C C - G C - G C - G A - T G - C A - T T T T C C G C C A T G A A | | | | G C C T C G G A C G G C G | | | | T T G G A G C T A A GTGTC A - T C - G G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |