Sequence ID | >WENV180098962 |
Genome ID | MTBK01278929 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 98332 |
End posion on genome | 98406 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gtgccattat |
tRNA gene sequence |
TCCGCAGTAGCTCAATGGCAGAGCATTCGGCTGTTAACCGAAGGGTTGTAAGTTCGAGTC |
Downstream region at tRNA end position |
atatttacaa |
Secondary structure (Cloverleaf model) | >WENV180098962 Asn GTT t GCCA atatttacaa T - A C - G C - G G - C C - G A - T G - C T G T C A T T C A A A A | | | | | G T C T C G G T A A G C G | | | | T T G G A G C C A A GGGTT T - A T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |