Sequence ID | >WENV180098963 |
Genome ID | MTBK01278929 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 364035 |
End posion on genome | 364122 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
taaaggccga |
tRNA gene sequence |
GCATGGGTGGTCGAGCGGTCAAAGGCAACGGGCTGTAAACCCGTCGGGTTAACTCCCTAC |
Downstream region at tRNA end position |
gtaatttgag |
Secondary structure (Cloverleaf model) | >WENV180098963 Tyr GTA a ACCA gtaatttgag G - C C - G A - T T - A G - C G - C G - C T A T C G T C C A C G A G | | | | | G G G C T G G C A G G C G | + | T T T A G G C C A A A CGGGTTAACTCCCTAC A - T C - G G - C G - C G - C C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |