Sequence ID | >WENV180098967 |
Genome ID | MTBK01278929 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 214007 |
End posion on genome | 213932 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
attgcggttc |
tRNA gene sequence |
GGGGACGTAGCTCAGCTGGGAGAGCGCATGAATGGCATTCATGAGGTCAGGGGTTCGATC |
Downstream region at tRNA end position |
atattatcaa |
Secondary structure (Cloverleaf model) | >WENV180098967 Ala GGC c ACCA atattatcaa G - C G - C G + T G - C A - T C - G G - C C T T T C C C C A C G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A G AGGTC C - G A - T T - A G - C A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |