Sequence ID | >WENV180098969 |
Genome ID | MTBK01278976 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 19862 |
End posion on genome | 19935 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gtgcttcaat |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCGCCAGCTTCCCAAGCTGGTAGCGTGGGTTCGATTCC |
Downstream region at tRNA end position |
gggatgacgc |
Secondary structure (Cloverleaf model) | >WENV180098969 Gly CCC t TCCA gggatgacgc G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A G TAGC C - G C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |