Sequence ID | >WENV180098979 |
Genome ID | MTBK01279725 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 672 |
End posion on genome | 758 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taaatgcctc |
tRNA gene sequence |
GCCGAGATGGTGGAATTGGCAGACACGCAGCGTTGAGGGCGCTGTGGGCAATAGCCTATG |
Downstream region at tRNA end position |
tttaaaaatt |
Secondary structure (Cloverleaf model) | >WENV180098979 Leu GAG c ACCA tttaaaaatt G - C C - G C - G G - C A - T G - C A - T T A T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C C A G G TGGGCAATAGCCTAT C - G A - T G - C C - G G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |