Sequence ID | >WENV180098981 |
Genome ID | MTBK01280035 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 155 |
End posion on genome | 63 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cttgccttct |
tRNA gene sequence |
GGAGACGTGACCGAGTGGCCGAAGGTGCTCCCCTGCTAAGGGAGTATGGGGTGTAGAGCC |
Downstream region at tRNA end position |
aaacagggtc |
Secondary structure (Cloverleaf model) | >WENV180098981 Ser GCT t GCCA aaacagggtc G - C G - C A - T G + T A - T C - G G - C T A T C T C C C A T G A G | | | | | G G G C C A G A G G G C G | | | T T C A G G T C G A G TATGGGGTGTAGAGCCTCATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |